Pathology: gastrointestinal stromal tumour

Gastrointestinal stromal tumour, spindle cell

  • Spindle cells in vague fascicles

  • Pale amphophilic cytoplasm with long tapering processes

  • Monomorphic spindle-ovoid nuclei; inconspicuous mitotic activity

  • Focal mucosal ulceration

  • IHC: H-caldesmon, CD34, CD117, DOG1

  • DNA-seq: KIT exon 11 mutation; c.1679T>A (p.Val560Asp)

Gastrointestinal stromal tumour, spindle cell

  • Lobulated; spindle cell fascicles

  • Pale amphophilic cytoplasm with long tapering processes

  • Ovoid and elongated nuclei with minimal pleomorphism; inconspicuous mitotic activity

  • IHC: CD34, CD117, DOG1

  • DNA-seq: KIT exon 11 mutation; c.1661_1705delAAGTACAGTGGAAGG (p.Glu554_Tyr586del)

Gastrointestinal stromal tumour, spindle cell

  • Lobulated; spindle cell fascicles

  • Pale amphophilic cytoplasm with long tapering processes

  • Ovoid and elongated nuclei with minimal pleomorphism; inconspicuous mitotic activity

  • IHC: CD117, DOG1

  • DNA-seq: KIT exon 11 mutation; c.1691_1726delATGGAAACAATTATGTTTACATAGAC

Gastrointestinal stromal tumour, spindle cell

  • Lobulated; spindle cell fascicles

  • Pale amphophilic cytoplasm with long tapering processes and occasional perinuclear vacuoles

  • Ovoid and elongated nuclei with minimal pleomorphism; conspicuous mitotic activity

  • Mucosal ulceration; focal myxoid stroma; patchy necrosis

  • IHC: H-caldesmon, keratin (AE1/AE3)*

  • DNA-seq: KIT exon 11 mutation; c.1673_1674insTCC (p.Lys558delinsAsnPro)

  • PMID: 18715619

Gastrointestinal stromal tumour, spindle cell

  • Lobulated; loose spindle cell fascicles

  • Eosinophilic cytoplasm with fibrillary processes and occasional perinuclear vacuoles

  • Ovoid and elongated nuclei with hint of palisading and minimal pleomorphism; inconspicuous mitotic activity

  • Attenuated mucosa

  • IHC: CD117

  • DNA-seq: KIT exon 9 mutation; c.1504_1509dupGCCTAT (p.Ala502_Tyr503dup)

Gastrointestinal stromal tumour, spindle-epithelioid cell

  • Lobulated; spindle-ovoid cell fascicles

  • Eosinophilic cytoplasm with fibrillary processes and occasional perinuclear vacuoles

  • Ovoid and elongated nuclei with minimal pleomorphism; inconspicuous mitotic activity

  • Focal oedema

  • IHC: CD34, smooth muscle actin, CD117, DOG1

  • DNA-seq: KIT exon 9 mutation; c.1504_1509dup (p.Ala502_Tyr503dup)

Gastrointestinal stromal tumour, spindle cell

  • Lobulated; spindle-ovoid cell fascicles

  • Eosinophilic cytoplasm with fibrillary processes and occasional perinuclear vacuoles

  • Ovoid and elongated nuclei with minimal pleomorphism; inconspicuous mitotic activity

  • IHC: CD117

  • DNA-seq: KIT exon 9 mutation; c.1504_1509dup (p.Ala502_Tyr503dup)

Gastrointestinal stromal tumour, spindle-epithelioid cell

  • Lobulated; spindle-ovoid cell fascicles

  • Granular amphophilic cytoplasm with fibrillary processes

  • Round-ovoid nuclei with prominent nucleoli and mild pleomorphism; occasional mitotic activity

  • Mucosal ulceration; chronic inflammatory infiltrate

  • IHC: CD34, CD117, DOG1

  • DNA-seq: KIT exon 13 mutation; c.1924A>G (p.Lys642Glu)

Gastrointestinal stromal tumour, epithelioid cell, SDHB-deficient

  • Lobulated; epithelioid cells with nested-pseudoacinar pattern

  • Granular eosinophilic cytoplasm

  • Round-ovoid nuclei with prominent nucleoli and minimal pleomorphism; inconspicuous mitotic activity

  • Focal necrosis; prominent capillary-sized vasculature

  • IHC: CD34, CD117, DOG1, SDHB

  • DNA-seq: negative

Gastrointestinal stromal tumour, epithelioid cell

  • Infiltrative; sheets of epithelioid cells

  • Glassy amphophilic cytoplasm

  • Ovoid nuclei with mild pleomorphism; inconspicuous mitotic activity

  • Interspersed mesenteric adipose tissue with a 'honeycomb' pattern

  • IHC: CD117, DOG1, SDHA, SDHB

  • DNA-seq: wild-type

Gastrointestinal stromal tumour, dedifferentiated

  • Spindle cells in vague fascicles

  • Pale amphophilic cytoplasm with fibrillary processes

  • Ovoid nuclei with marked pleomorphism and frequent multinucleation; conspicuous mitotic activity

  • Mucosal ulceration; focal myxoid stroma; patchy necrosis

  • IHC: CD34, CD117, DOG1

  • DNA-seq: KIT exon 11 mutation; c.1679T>A (p.Val560Asp)

Gastrointestinal stromal tumour, spindle-epithelioid cell

  • Spindle-epithelioid cells in vague fascicles

  • Pale amphophilic cytoplasm with fibrillary processes

  • Monomorphic ovoid nuclei with small nucleoli; inconspicuous mitotic activity

  • IHC: CD34, CD117, DOG1

  • DNA-seq: PDGFRA exon 18 mutation; c.2525A>T (p.Asp842Val)

Gastrointestinal stromal tumour, calcified

  • Spindle cells with loose fascicular-reticular pattern

  • Eosinophilic cytoplasm with fibrillary processes

  • Ovoid and elongated nuclei with minimal pleomorphism; inconspicuous mitotic activity

  • Prominent dystrophic calcification

  • IHC: CD117, DOG1

  • DNA-seq: PDGFRA exon 12 mutation; c.1682T>A (p.Val561Asp)

Gastrointestinal stromal tumourlet, (minute gastric sclerosing stromal tumour)

  • Nodular; spindle cell fascicles

  • Eosinophilic cytoplasm

  • Ovoid and elongated nuclei with minimal pleomorphism; inconspicuous mitotic activity

  • Prominent collagenous stroma with dystrophic calcification

  • IHC: CD117, DOG1

  • DNA-seq: CKIT exon 11 mutation; c.1662T_1667delAGTACA (p.Val555_Gln556del)

  • PMID: 17197927