Circumscribed; cellular
Spindle cells with loose fascicular pattern
Eosinophilic cytoplasm
Ovoid hyperchromatic nuclei with mild atypia and occasional pseudonuclear inclusions; inconspicuous mitotic activity
Vessels with hyalinized walls
IHC: S100, SOX10
DNA-Seq: NF2 mutation (c.790_810+17delATCTCGTACAGTGACAAGGAGGTAGGACATGTGTGTAC; p.Ile264_Glu270del)
Circumscribed; areas of hyper- ("Antoni A") and hypo- ("Antoni B") cellularity
Spindle cells with loose fascicular and microcystic pattern
Eosinophilic cytoplasm
Ovoid hyperchromatic nuclei with mild atypia and occasional palisading; inconspicuous mitotic activity
Circumscribed; areas of hyper- ("Antoni A") and hypo- ("Antoni B") cellularity
Spindle cells with loose fascicular pattern
Eosinophilic cytoplasm
Ovoid hyperchromatic nuclei with mild atypia and occasional palisading; inconspicuous mitotic activity
Ectatic blood vessels with hyalinized walls
IHC: S100, SOX10, INI1
Circumscribed; areas of hyper- ("Antoni A") and hypo- ("Antoni B") cellularity
Spindle cells with loose fascicular pattern
Eosinophilic cytoplasm
Ovoid hyperchromatic nuclei with mild atypia; inconspicuous mitotic activity
Ectatic vessels with hyalinized walls
IHC: S100
Circumscribed; areas of hyper- ("Antoni A") and hypo- ("Antoni B") cellularity
Spindle cells with loose fascicular pattern
Eosinophilic cytoplasm
Ovoid hyperchromatic nuclei with mild atypia; inconspicuous mitotic activity
Vessels with hyalinized walls
IHC: S100
Circumscribed; areas of hyper- ("Antoni A") and hypo- ("Antoni B") cellularity
Spindle cells with loose fascicular pattern
Eosinophilic cytoplasm
Ovoid hyperchromatic nuclei with mild atypia; inconspicuous mitotic activity
Ectatic vessels with hyalinized walls
IHC: S100
Circumscribed; areas of hyper- ("Antoni A") and hypo- ("Antoni B") cellularity
Spindle-epithelioid cells with loose fascicular and rosette-like patterns
Eosinophilic cytoplasm
Ovoid hyperchromatic nuclei with mild atypia; inconspicuous mitotic activity
Dystrophic calcification
IHC: S100, SOX10, epithelial membrane antigen
PMID: 10193326
Circumscribed; areas of hyper- ("Antoni A") and hypo- ("Antoni B") cellularity
Spindle cells with loose fascicular and microcystic pattern
Eosinophilic cytoplasm
Ovoid hyperchromatic nuclei with mild atypia and occasional palisading; inconspicuous mitotic activity
IHC: S100, SOX10
Circumscribed; areas of hyper- ("Antoni A") and hypo- ("Antoni B") cellularity
Spindle cells with loose fascicular and microcystic pattern
Eosinophilic cytoplasm
Ovoid hyperchromatic nuclei with mild atypia and occasional palisading; inconspicuous mitotic activity
IHC: S100, SOX10
Circumscribed; areas of hyper- ("Antoni A") and hypo- ("Antoni B") cellularity
Spindle cells with loose fascicular and microcystic pattern
Eosinophilic cytoplasm
Ovoid hyperchromatic nuclei with mild atypia and occasional palisading; inconspicuous mitotic activity
IHC: S100, SOX10
Circumscribed; areas of hyper- ("Antoni A") and hypo- ("Antoni B") cellularity
Spindle cells with loose fascicular pattern
Eosinophilic cytoplasm
Ovoid hyperchromatic nuclei with mild atypia; inconspicuous mitotic activity
Occasional small hyalinized vessels
IHC: S100, SOX10
Lobulated with peripheral lymphocytic cuff
Spindle cells with vague fascicular pattern
Eosinophilic cytoplasm
Ovoid nuclei with small nucleoli and mild atypia; rare mitotic activity
Inconspicuous vasculature
IHC: S100, SOX10
PMID: 2400975
Lobulated; areas of hyper- ("Antoni A") and hypo- ("Antoni B") cellularity
Spindle cells with fascicular pattern
Eosinophilic cytoplasm
Ovoid monomorphic nuclei with inconspicuous mitotic activity
IHC: S100, SOX10
DNA-Seq: NF2 mutation (c.169C>T; p.Arg57*)
Ill-defined margin; areas of hyper- ("Antoni A") and hypo- ("Antoni B") cellularity
Spindle cells with nodular pattern
Eosinophilic cytoplasm
Ovoid monomorphic nuclei with inconspicuous mitotic activity
IHC: S100
PMID: 9568513